View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16807_low_13 (Length: 257)
Name: NF16807_low_13
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16807_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 15 - 158
Target Start/End: Original strand, 5832334 - 5832473
Alignment:
| Q |
15 |
aagaacagaacatgaataaacattgctctaaatgtaaggaaaggtgagcaatgattatttttgtgagaattaaaaagaaccaaacttccttgcatagaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5832334 |
aagaacagaacatgaataaacattgctctaaatgtaaggaaaggtgagca-tgattatttttgtgagaattaaaaagaacaaaacttccttgcatagaag |
5832432 |
T |
 |
| Q |
115 |
aattaaagaaactttagaataaataaatatatgtcacgctttag |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5832433 |
aattaaagaaactttagaata---aaatatatgtcacgctttag |
5832473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 168 - 257
Target Start/End: Original strand, 5832458 - 5832548
Alignment:
| Q |
168 |
atatgtcacactttagtctccaaaattgtagatattggacaatttggtctcttaaactaattaaaatactaaaa-atcactaaaatataca |
257 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||| |||||||||||| |
|
|
| T |
5832458 |
atatgtcacgctttagcctccaaaattgtagatattggacaatttggtctcttaaactaatgaaaatacgaaaacatctctaaaatataca |
5832548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University