View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16807_low_17 (Length: 249)
Name: NF16807_low_17
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16807_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 17609679 - 17609439
Alignment:
| Q |
1 |
actgccgcaaaataaagattttagaggtctttgcagtggcatcaatattgcaaccgcagctgaatcagctgcattttccgctatatcaaggtttgcagac |
100 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17609679 |
actgcctcagaataaagattttagaggtctttgcagtggcatcaatattgcaaccgcagctgaatcagctgcattttccgcgatatcaaggtttgcagac |
17609580 |
T |
 |
| Q |
101 |
cgttaccgcaatatagaaccacgagggaaagaacaaacattcatgttgttaatgaaaatatgaaaaactcacctgtcccctgctgagcatttcagacttt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17609579 |
cgtgaccgcaatatagaaccacgagggaaagaacaaacattcatgttgttaatgaaaatatgaaaaactcacctgtcccctgctgagcatttcagacttt |
17609480 |
T |
 |
| Q |
201 |
ttcaactttttcatggcatatatattaccggatttcatctc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
17609479 |
ttcaactttttcatggcatatatattgccggatttcttctc |
17609439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 236
Target Start/End: Complemental strand, 48258400 - 48258332
Alignment:
| Q |
168 |
ctcacctgtcccctgctgagcatttcagactttttcaactttttcatggcatatatattaccggatttc |
236 |
Q |
| |
|
|||||||| || || |||||||||||||| || |||| ||||||||||||||| ||||| || |||||| |
|
|
| T |
48258400 |
ctcacctggcctctcctgagcatttcagatttcttcagctttttcatggcatagatatttccagatttc |
48258332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University