View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16807_low_20 (Length: 238)
Name: NF16807_low_20
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16807_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 128 - 222
Target Start/End: Original strand, 31536853 - 31536947
Alignment:
| Q |
128 |
gtttgacgtattttctttgcagggagaagtgatttgccttgaaaagcaggtgcaccaatttgcattagtccacgaaaatatcactaagacattgg |
222 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31536853 |
gtttgaagtattttctttgcagggagaggtgatttgccttgaaaagcaggtgcaccaatttgcatcagtccacgaaaatatcactaagacattgg |
31536947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 31536723 - 31536755
Alignment:
| Q |
1 |
attattattagtactagttagtagtaatgattt |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31536723 |
attattattagtactagttagtagtaatgattt |
31536755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University