View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16807_low_26 (Length: 202)
Name: NF16807_low_26
Description: NF16807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16807_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 42311956 - 42311775
Alignment:
| Q |
17 |
aaggcacgtcagtcagtggtcaagctccaggtaaatttttacttcatgttttttctcttct-----------atttgctagatcacagggaattggttat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42311956 |
aaggcacgtcagtcagtggtcaagctccaggtaaatttttacttcatgttttttctcttctttttgtcacctatttgctagatcacagggaattggttat |
42311857 |
T |
|
| Q |
106 |
acatttttgtatgcctgaattttgatttcagagaggggatcccaagtatcgcgaagcatggcataaaatttgtgaagttagt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42311856 |
acatttttgtatgcctgaattttgatttcagagaggggatcccaagtatcgcgaagcatggcataaaatttgtgaagttagt |
42311775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 94 - 187
Target Start/End: Original strand, 51566497 - 51566591
Alignment:
| Q |
94 |
ggaattggttatacattttt-gtatgcctgaattttgatttcagagaggggatcccaagtatcgcgaagcatggcataaaatttgtgaagttagt |
187 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||||| |||||| | |||||||||| |||||| |
|
|
| T |
51566497 |
ggaattggttttacattttttgtctgcctgaattttgatttcagggaggggatcccaagtatcgcacggcatggaaacaaatttgtgatgttagt |
51566591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 51566401 - 51566443
Alignment:
| Q |
26 |
cagtcagtggtcaagctccaggtaaatttttacttcatgttttt |
69 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
51566401 |
cagtcagtggtcaagctccaggtaaa-ttttacttcaagttttt |
51566443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 76 - 157
Target Start/End: Complemental strand, 47976333 - 47976248
Alignment:
| Q |
76 |
ctatttgctagatcacagggaattggttatacattttt-gtatgcctgaattttgatttcagagagg---ggatcccaagtatcgc |
157 |
Q |
| |
|
|||||||| || ||| ||||||||||| ||||||||| ||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
47976333 |
ctatttgcaaggtcatggggaattggttttacattttttgtatgcctgaattttgatttcagagtggggaggatcccaagtatcgc |
47976248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University