View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_high_17 (Length: 290)
Name: NF16808_high_17
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 8 - 273
Target Start/End: Complemental strand, 3950357 - 3950089
Alignment:
| Q |
8 |
agagatgaattttggagataagaaattgtatttatcttaattttcaggtcaaaattaagatcaaaagcaagcacattggaggagctttctccaaaaagca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3950357 |
agaggtgaattttggagataagaaattgtatttatcttaattttcaggtcaaaattaagatcaaaagcaagcacattggaggagctttctccaaaaagca |
3950258 |
T |
 |
| Q |
108 |
taaatgtaagcatttttatacatatcctgactgtaacaaacaacaatcatatgcgcaacttgctgcaactatctattgccaatatgtcattgtaaaaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3950257 |
taaatgtaagcatttttatacatatcctgactgtaacaaacaacaatcatatgcgcaacttgctgcaactatctattgccaatatgtcattgtaaaaatc |
3950158 |
T |
 |
| Q |
208 |
attttcttcagatatttctgtacggt---tctttcttttgagtctacattggttattgtaggtgtggtt |
273 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3950157 |
attttcttcagatatttctgtacggttcttctttcttttgagtctacattggttattgtaggtgtggtt |
3950089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University