View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_high_23 (Length: 238)
Name: NF16808_high_23
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 33636463 - 33636646
Alignment:
| Q |
17 |
attgatgttgtcttgaatacaatacatatttgacactaggacacgtatgcttcatagacatcaaaaaaggtaagttattttaccattttctcatataaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636463 |
attgatgttgtcttgaatacaatacatatttgacattaggacacgtatgcttcatagacatcaaaaaaggtaagttattttaccattttctcatataaga |
33636562 |
T |
|
| Q |
117 |
tttgaactctgtcactaaaggtaggttatttttggaaaagtagtagtcggttctcatgatgtggtgggtgatgttggacattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636563 |
tttgaactctgtcactaaaggtaggttatttttggaaaagtagtagtcggttctcatgatgtggtgggtgatgttggacattgg |
33636646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University