View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_high_24 (Length: 237)
Name: NF16808_high_24
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 32650811 - 32650986
Alignment:
| Q |
13 |
gagatgaacgaatgaaagatttttgttttgagaaataaagagttgattnnnnnnngctaaccactataaatatcttctgtctccttcttcgattatgtgg |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
32650811 |
gagatgaacgaatgaaagatttttggtttgagaaataaagagttgattaaaaaaagctaaccactgtaaatatcttctgtctccttcttcaattgtgtgg |
32650910 |
T |
 |
| Q |
113 |
atatggggttggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650911 |
atatggggttggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta |
32650986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 33854148 - 33854099
Alignment:
| Q |
139 |
aatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33854148 |
aatcaaagtggacgaaggtgatagaaattggagaagaatgaatggcagta |
33854099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 33854239 - 33854179
Alignment:
| Q |
79 |
taaatatcttctgtctccttcttcgattatgtggatatggggttggagttgtggagaggaa |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
33854239 |
taaatatcttttgtctccttcttcgattgtgtggatatgggtttggagttatggagaggaa |
33854179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University