View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_high_29 (Length: 212)
Name: NF16808_high_29
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 39878914 - 39879092
Alignment:
| Q |
15 |
gagcagagagggacccttgaggttgagagtgactggtgagactgnnnnnnncacagacctcttcttcaatttctgtttatccatctcatcttctcaacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39878914 |
gagcagagagggacccttgaggttgagagtgactggtgagactgaaaaaaacacagacctcttcttctatttctgtttatccatctcatcttctcaacta |
39879013 |
T |
|
| Q |
115 |
attttactgcccactattttccattattatcattctttcattgtcattttttggacaaatatgtcacaatattaaatgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39879014 |
attttactgcccactattttccattattatctttctttcattgtcattttttggacaaatatgtcacaatattaaatgt |
39879092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University