View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_low_10 (Length: 412)
Name: NF16808_low_10
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 235 - 314
Target Start/End: Complemental strand, 32339837 - 32339758
Alignment:
| Q |
235 |
atgtcacattgagtatgatttccactgttaattgattattcaagggactaggtagcttttttgagcacttcatttccatt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32339837 |
atgtcacattgagtatgatttccactgttaattgattattcaagggactaggtagcttttttgagcacttcatttccatt |
32339758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 379
Target Start/End: Complemental strand, 32006813 - 32006768
Alignment:
| Q |
334 |
tcatttgagggtgtttgataggtgctgctgctgtttttatttttct |
379 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||||||||| |
|
|
| T |
32006813 |
tcatttgagggcgtttgacaggtgctgctgctgtgtttatttttct |
32006768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 28766447 - 28766497
Alignment:
| Q |
132 |
tctcaatttacctgatataagacatgagctaaggtttaaggttgacaaaat |
182 |
Q |
| |
|
|||||||| |||||||| |||||||| |||||| ||||| ||||||||||| |
|
|
| T |
28766447 |
tctcaattgacctgatacaagacatgggctaagttttaaagttgacaaaat |
28766497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University