View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_low_21 (Length: 256)
Name: NF16808_low_21
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 20181564 - 20181341
Alignment:
| Q |
13 |
catagggtattgaatgcctagactaggacccccaactgctcttaactaaaacagttatagcagactggaaaatcagtaaaattactgatacatagtaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20181564 |
catagggtattgaatgcctagactaggacccc-aactgctcttaactaaaacagttatagcagactggaaaatcagtaaaattactgatacatagtaaaa |
20181466 |
T |
 |
| Q |
113 |
catagctgcctaggtttctttctacgtgtgaactcaagtgttaattgccggaaagaaattttaccattttgtttctgtccaaaacatcatgttaattatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20181465 |
catagctgcctaggtttctttctacgtgtgaactcaagtgttaattgccggaaagaaattttaccattttgtttctgtccaaaacatcatgttaattatt |
20181366 |
T |
 |
| Q |
213 |
aattaaattaatagaagtagcaaca |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
20181365 |
aattaaattaatagaagtagcaaca |
20181341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University