View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_low_24 (Length: 247)
Name: NF16808_low_24
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 47585422 - 47585647
Alignment:
| Q |
1 |
gccgggaaagtttgatattgctggccatagtcaccaactttttcatgtcttggttgtggcgggggcatatacacattaccgtgatgggttaatttacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47585422 |
gccgggaaagtttgatattgctggccatagtcaccaactttttcatgtcttggttgtggcgggggcatatacacattaccgtgatgggttaatttacctt |
47585521 |
T |
 |
| Q |
101 |
agatggagagatttgaaaggctgttaattaggccggtagggagtctgttgtaggtactttggctttctttttgttgttcaaaacttagagatattggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47585522 |
agatggagagatttgaaaggctgttaattaggccggtagggagtctgttgtaggtactttggctttctttttgttgttcaaaactt--agatattggatg |
47585619 |
T |
 |
| Q |
201 |
aaagatgaagaaagtgattgtgtattat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47585620 |
aaagatgaagaaagtgattgtgtattat |
47585647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University