View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16808_low_27 (Length: 232)
Name: NF16808_low_27
Description: NF16808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16808_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 30997910 - 30997704
Alignment:
| Q |
16 |
agaacaacacaacatgaataaagtttggcttcttgtactaatgatgttcaaccatggccttcctataaaaacaatcagcaatgtttctgcaagaccaagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30997910 |
agaacaacacaacatgaataaagtttggcttcttgtactaatgatgttctacaatagccttcctataaaaacaatcagcaatgtttctgcaagaccaagt |
30997811 |
T |
 |
| Q |
116 |
actatcaatattggtgcaattttatctttcaattcaaccattggaagagtggctaaagtagccatagaagcagcagtggatgatataaattccaatccac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30997810 |
actatcaatattggtgcaattttatctttcaattcaaccattggaagagtggctaaagttgccatagaagcagcagtggatgatataaattccaatccaa |
30997711 |
T |
 |
| Q |
216 |
aggttct |
222 |
Q |
| |
|
||||||| |
|
|
| T |
30997710 |
aggttct |
30997704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University