View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_high_29 (Length: 285)
Name: NF16809_high_29
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_high_29 |
 |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0693 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 125 - 269
Target Start/End: Complemental strand, 4532 - 4389
Alignment:
| Q |
125 |
atttaaaagaacttccctagatctgtctcttaaccatactaagataatgagtaaacaatttgacccactcttttggtaaatatgctttcatgctttgact |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4532 |
atttaaaagaacttccctagatctatctcttaaccatactaagataatgagtaa-caatttgacccactcttttgctaaatatgctttcatgctttgact |
4434 |
T |
 |
| Q |
225 |
catgtagaaggggtgtcgttagaagatcaatcacttttctgactt |
269 |
Q |
| |
|
||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4433 |
catctagaaggggtgtcgttagaagatgtatcccttttctgactt |
4389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 30 - 121
Target Start/End: Complemental strand, 4934 - 4843
Alignment:
| Q |
30 |
aaatagtaagacaaacatataatttagacacaagagagtgaatagcctgatttgcttgtctctatgcgaacttacccattaattaagttatt |
121 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||| |
|
|
| T |
4934 |
aaatagtaagacaaacatacaatttagacacaagagagtgaatagcctgatttgcttgtctctttgggaacttacccattaataaagttatt |
4843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University