View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_high_40 (Length: 224)
Name: NF16809_high_40
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 28089589 - 28089791
Alignment:
| Q |
1 |
ttaaatgttacgccattagtgtaaaatttgacggtcagatttcaatacttcaagtcatctctaatattgaaagg-tctaatttcgaagaagnnnnnnnnn |
99 |
Q |
| |
|
||||||||||||| || | |||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28089589 |
ttaaatgttacgcaataaatgtaaaatttgacggtcaaatttcaatacttcaaatcatctctaatattgaaagggtctaatttcgaagaagaaaaaaaa- |
28089687 |
T |
 |
| Q |
100 |
cttataatgttattttctcttagaattagtttctttgatattggagaaaattcaaactcaaatttcaatggtgtttttcatgtatgtgtatatgttaggt |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28089688 |
cttataatgttattttctcttcgaattagtttctttgatattggagaaaattcaaactcaaatttcgatggtgtttttcatgtatgtgtatatgttaggt |
28089787 |
T |
 |
| Q |
200 |
tctt |
203 |
Q |
| |
|
|||| |
|
|
| T |
28089788 |
tctt |
28089791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University