View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_high_41 (Length: 220)
Name: NF16809_high_41
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 67 - 203
Target Start/End: Complemental strand, 32899560 - 32899424
Alignment:
| Q |
67 |
cttgaattaccaaaaagctgtaatatccatgaaacttgttgttgtaaccatgtaaccaattgacagcgtagcaaaaatgaactgtgacatcctcagaatg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899560 |
cttgaattaccaaaaagctgtaatatccatgaaacttgttgttgtaaccatgtaaccaattgacagcgtagcaaaaatgaactgtgacatcctcagaatc |
32899461 |
T |
|
| Q |
167 |
agaccaaggacagtacctggtgtcccaggaaagtcct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32899460 |
agaccaaggacagtacctggtgtcccaggaaactcct |
32899424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 67 - 203
Target Start/End: Complemental strand, 32866985 - 32866849
Alignment:
| Q |
67 |
cttgaattaccaaaaagctgtaatatccatgaaacttgttgttgtaaccatgtaaccaattgacagcgtagcaaaaatgaactgtgacatcctcagaatg |
166 |
Q |
| |
|
||||||||||||||| || |||| || | |||||||| || || ||||||| || ||||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
32866985 |
cttgaattaccaaaaggcagtaaaattaaagaaacttgatgatgaaaccatgaaagcaattgagcctgctgcaaaaatgaactgtgacaacctcagaatc |
32866886 |
T |
|
| Q |
167 |
agaccaaggacagtacctggtgtcccaggaaagtcct |
203 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
32866885 |
aaaccaaggacagtacctggtgtcccaggaaaatcct |
32866849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 194
Target Start/End: Original strand, 16324711 - 16324771
Alignment:
| Q |
134 |
gtagcaaaaatgaactgtgacatcctcagaatgagaccaaggacagtacctggtgtcccag |
194 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | |||||| |||||||| ||||| |||| |
|
|
| T |
16324711 |
gtagcaaaaatgaactgtgacatcctaagaatcaaaccaagaacagtaccaggtgtaccag |
16324771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University