View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_high_46 (Length: 203)
Name: NF16809_high_46
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 50224580 - 50224412
Alignment:
| Q |
17 |
gaataatacaaaagggaataaacaatcttcaaatcagcaaaagaatcaataaaaagatgataaacatagaagtaccctgcagtaatacttgaattttgtg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50224580 |
gaataatacaaaagggaataaacaatcttcaaatcagcaaaagcatcaataaaaatatgataaacatagaagtaccctgcagtaatacttgaattttgtg |
50224481 |
T |
 |
| Q |
117 |
aaataaaggttgtctgcgatgactataacagcatgctgccgcttcattgagaaccactgcagtacaaac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50224480 |
aaataaaggttgtctgcgatgactataacagcatgctgccgcttcattgagaaccactgcagtacaaac |
50224412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 178
Target Start/End: Complemental strand, 52958741 - 52958701
Alignment:
| Q |
138 |
actataacagcatgctgccgcttcattgagaaccactgcag |
178 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
52958741 |
actataacagcatgctgccgcttcatagaaaaccactgcag |
52958701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University