View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_low_14 (Length: 397)
Name: NF16809_low_14
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 163 - 381
Target Start/End: Complemental strand, 12155137 - 12154919
Alignment:
| Q |
163 |
ggattgtatccctttccatgcttcttccaagttgtttctttttacaataacaccattgacttctttcttcataaccaataactcaacaagcaaatgagag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12155137 |
ggattgtatccctttccatgcttcttccaagttgtttctttttacaataacaccattgacttctttcttcataaccaataactcaacaagcaaatgagag |
12155038 |
T |
 |
| Q |
263 |
ttctcagcatctgcttttttggactctgcatccatctcccagaaagatgccatctccatatcaagggcttctgaaatatctgcctttttattcctagcaa |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12155037 |
ttctcagcatctgcttttttggactctgcatccatctcccagaaagaggccatctccatatcaagggcttctgaaatatctgcctttttattcctagcaa |
12154938 |
T |
 |
| Q |
363 |
tttgaagttcatgttcaag |
381 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12154937 |
tttgaagttcatgttcaag |
12154919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 14 - 117
Target Start/End: Complemental strand, 12155287 - 12155184
Alignment:
| Q |
14 |
aatatcaatcaatgggcaatatttaaaatactataaacaaactattcatgaaatcaaaataaacttaaggctagaagacatgatattacatattgattat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12155287 |
aatatcaatcaatgggcaatatttaaaatactataaacaaactattcatgaaatcaaaataaacttaaggctagaagacatgatattacatattgattat |
12155188 |
T |
 |
| Q |
114 |
atgc |
117 |
Q |
| |
|
|||| |
|
|
| T |
12155187 |
atgc |
12155184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University