View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_low_15 (Length: 396)
Name: NF16809_low_15
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 17 - 386
Target Start/End: Complemental strand, 8277472 - 8277103
Alignment:
| Q |
17 |
ccaatttggtgcaaccaaatcatactttgtcgttccaaattgcagtttagaaaaatgacactcttctagctgaatagcatcaacactgcatccattgctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8277472 |
ccaatttggtgcaaccaaatcatactttgtcgttccaaattgcagtttagaaaaatgacactcttctagctgaatagcatcaacactgcatccattgctg |
8277373 |
T |
 |
| Q |
117 |
tcaatgttagataatgccaatggtcctgacctactagcaggagtgttatggcgcgcaggcgatgaactcttgaatggtgtgtgacatcttgaagttgtgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8277372 |
tcaatgttagataatgccaatggtcctgacctactagcaggagtgttatggcgcgcaggcgatgaactcttgaatggtgtgtgacatcttgaagttgtgg |
8277273 |
T |
 |
| Q |
217 |
aacttcccaatggagtcatttctgtgccaacatctttgtgtttaacttcatgaatcacttctgtgtaagattcatgcattgcctcacaagcttgatttct |
316 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8277272 |
aacttcctaatggagtcatttctgtgccaacatctttgtgtttaacttcatgaatcacttctgtgtaagattcatgcattgcctcacaagcttgatttct |
8277173 |
T |
 |
| Q |
317 |
gaataagaatccttcttttgttggttctgaataccggaattttggtaaaattggctctatgctgtctgtg |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8277172 |
gaataagaatccttcttttgttggttctgaataccggaattttggtaaaattggctctatgctgtctgtg |
8277103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University