View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_low_27 (Length: 297)
Name: NF16809_low_27
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 53 - 290
Target Start/End: Original strand, 39505200 - 39505437
Alignment:
| Q |
53 |
ttatcttcacttgcggctcttcatggaagagaagcaaaaagaatgaacaatttcaatcagtcattctaatcatatggcaactgtttttaggatacagaaa |
152 |
Q |
| |
|
||||||||| ||| | ||||| |||||||||||||||| |||||||| |||||||||| || |||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
39505200 |
ttatcttcatttgtgactctttgtggaagagaagcaaaaggaatgaactatttcaatcaatcgctctaatcacatggcaactgcttttaggttacagaaa |
39505299 |
T |
 |
| Q |
153 |
gtcctggtcatgctttgagaaagcagcctctggaatcaaaacttgagccacgcattgcaaaatttatatcccttgtttgcaatttgagcatgatgaatca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
39505300 |
gtcctggtcatgctttgagaaagcagcctcaggaatcaaaacttgagccacgtattgcaaaatttatatcgcttgtttgcaatttgagcatgatgaacca |
39505399 |
T |
 |
| Q |
253 |
gcaaatgacggagataggttagtttttacttcttttct |
290 |
Q |
| |
|
|||||||| ||| ||||||||| ||| ||||||||||| |
|
|
| T |
39505400 |
gcaaatgatggaaataggttagctttcacttcttttct |
39505437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University