View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16809_low_27 (Length: 297)

Name: NF16809_low_27
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16809_low_27
NF16809_low_27
[»] chr1 (1 HSPs)
chr1 (53-290)||(39505200-39505437)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 53 - 290
Target Start/End: Original strand, 39505200 - 39505437
Alignment:
53 ttatcttcacttgcggctcttcatggaagagaagcaaaaagaatgaacaatttcaatcagtcattctaatcatatggcaactgtttttaggatacagaaa 152  Q
    ||||||||| ||| | |||||  |||||||||||||||| |||||||| |||||||||| ||  |||||||| |||||||||| ||||||| ||||||||    
39505200 ttatcttcatttgtgactctttgtggaagagaagcaaaaggaatgaactatttcaatcaatcgctctaatcacatggcaactgcttttaggttacagaaa 39505299  T
153 gtcctggtcatgctttgagaaagcagcctctggaatcaaaacttgagccacgcattgcaaaatttatatcccttgtttgcaatttgagcatgatgaatca 252  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||    
39505300 gtcctggtcatgctttgagaaagcagcctcaggaatcaaaacttgagccacgtattgcaaaatttatatcgcttgtttgcaatttgagcatgatgaacca 39505399  T
253 gcaaatgacggagataggttagtttttacttcttttct 290  Q
    |||||||| ||| ||||||||| ||| |||||||||||    
39505400 gcaaatgatggaaataggttagctttcacttcttttct 39505437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University