View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_low_28 (Length: 291)
Name: NF16809_low_28
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 239
Target Start/End: Original strand, 38140216 - 38140441
Alignment:
| Q |
14 |
ataaaataaagtgatgctaaccaagataaggccgttgcatgttactactgtacttccaagtcacagagtaataaaaacaccagtttcatccttcaatctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38140216 |
ataaaataaagtgatgctaaccaagataaggccgttgcatgttactactgtacttccaagtcacagagtaataaaaacaccagtttcatccttcaatctt |
38140315 |
T |
 |
| Q |
114 |
ttagatattagaactttcataaaagatgactgtgtttgatctcaaacagagttttggcttgaaaaacttatgggaaatgttttgcattggcagcttggca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38140316 |
ttagatattagaactttcataaaagatgactgtgtttgatctcaaacagagttttggcttgaaaaacttatgggaaatgttttgcattggcagcttggca |
38140415 |
T |
 |
| Q |
214 |
gaaagtacgctatactttgctctccc |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38140416 |
gaaagtacgctatactttgctctccc |
38140441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 38163205 - 38163245
Alignment:
| Q |
144 |
tgtgtttgatctcaaacagagttttggcttgaaaaacttat |
184 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
38163205 |
tgtgtttgatctcaaacggaattttggcttgaaaaacttat |
38163245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University