View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_low_45 (Length: 211)
Name: NF16809_low_45
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 42704726 - 42704913
Alignment:
| Q |
10 |
agaagcaaaggataaatggaagaagcaccactgcactac--cacacacacactgtctccatctgttcctttttaacagatttt---gnnnnnnnnnnaaa |
104 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42704726 |
agaagtaaaggataaatggaagaagcaccactgcactaccacacacacacactgtctccatctgttcctttttaacagattttttattattttttttaaa |
42704825 |
T |
|
| Q |
105 |
ggagaagggtgagtattttttaaggaattgattcaaagagtgtaacacaaggtagnnnnnnnncttcatatgatatatagagacccatc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42704826 |
ggagaagggtgagtattttttaaggaattgattcaaagagtgtaacacaaggtagtttttttt-ttcatatgatatatagagacccatc |
42704913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University