View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16809_low_50 (Length: 201)
Name: NF16809_low_50
Description: NF16809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16809_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 4e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 3808782 - 3808921
Alignment:
| Q |
1 |
tctatatatttatttatgcagcttgtaattatgnnnnnnngttaacaaagattttgagcaacactcgaagggtcatcctcttggacatcaattatgcgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3808782 |
tctatatatttatttatgcagcttgtaattatgtttttttgttaacaaagattttgagcaacactcaaagggtcatccgcttggacatcaattatgcgat |
3808881 |
T |
 |
| Q |
101 |
aagcttaacataacttgccatttactcatgtagaggtcga |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
3808882 |
aagcttaacggaacttgccatttactcatgcagaggtcga |
3808921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University