View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681-Insertion-9 (Length: 506)
Name: NF1681-Insertion-9
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681-Insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 470; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 470; E-Value: 0
Query Start/End: Original strand, 8 - 489
Target Start/End: Complemental strand, 39663404 - 39662923
Alignment:
| Q |
8 |
agttgaaggtgtctgtcttcttatttgaggggaatgttggctggctcgaggcttttcagtttcacaaaggaagttcagtcttaattgtatgaactataag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663404 |
agttgaaggtgtctgtcttcttatttgaggggaatgttggctggctcgaggcttttcagtttcacaaaggaagttcagtcttaattgtatgaactataag |
39663305 |
T |
 |
| Q |
108 |
gcttcggaccaggcttcattcccctcaaaatcttaattgtttcttcttgtgagtgtatccttattatatatgaaatcatctctatatatctacctattta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663304 |
gcttcggaccaggcttcattcccctcaaaatcttaattgtttcttcttgtgagtttatccttattatatatgaaatcatctctatatatctacctattta |
39663205 |
T |
 |
| Q |
208 |
gatttgtaaagatcaaagagaagcaagagttaggttgagaggaacgttgtctggctcgaggtgatggagatggaagagtactctctactcactcatcact |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663204 |
gatttgtaaagatcaaagagaagcaagagttaggttgagaggaacgttgtctggctcgaggtgatggagatggaagagtactctctactcactcatcact |
39663105 |
T |
 |
| Q |
308 |
aactttcaatctcggaccaggcttcattccccccagcaaacttttgctagctatacttcattttcctaacttctccttcatatgtagcatcattttcttc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39663104 |
aactttcaatctcggaccaggcttcattccccccagcaaacttttgctagctatacttcattttcctaatttctccttcatatgtagcatcattttcttc |
39663005 |
T |
 |
| Q |
408 |
ttctggtttggttttggtaaggttttctgctccttctcatagtttctgtcacatatatagcataaaacaagactcttttatg |
489 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39663004 |
ttctggtttggttttggtaaggttttctgctccttctcatagtttctgtcacatatatagcataaaacaagtctcttttatg |
39662923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University