View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16810_high_1 (Length: 374)
Name: NF16810_high_1
Description: NF16810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16810_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 357
Target Start/End: Complemental strand, 24809925 - 24809587
Alignment:
| Q |
16 |
tcagcagttcatttagatgagaaggtgtacaatgaagctaaaaatttcaatccttggagatggatggaacctgaaaatgaggttaatccacataccattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24809925 |
tcagcagttcatttagatgagaaggtgtacaatgaagctaaaaatttcaatccttggagatggatggaacctgaaaatgaggttaatccacataacattt |
24809826 |
T |
 |
| Q |
116 |
tagtgaatactgcatatatataattttgtacttgtatttcnnnnnnnntttcttaattgttatggtctcaattatgaaggaaaagagaaattggagaagt |
215 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24809825 |
tagtgaatactgtatata---atttttgtacttgtatttcaaattttttttcttaattgttatggtctcaattatgaaggaaaagagaaattggagaagt |
24809729 |
T |
 |
| Q |
216 |
agtccattttatgcaccctttggaggaggtgctagattttgtcctggagctgagctagctcgccttcaaattgctctttttcttcattactttgttacaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24809728 |
agtccattttatgcaccctttggaggaggtgctagattttgtcctggagctgagctagctcgccttcaaattgctctttttcttcattactttgttacaa |
24809629 |
T |
 |
| Q |
316 |
actataggtaatgcctctctctccctccctcttgaccatagc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24809628 |
actataggtaatgcctctctctccctccctcttgaccatagc |
24809587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University