View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16810_low_3 (Length: 258)
Name: NF16810_low_3
Description: NF16810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16810_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 7891538 - 7891765
Alignment:
| Q |
12 |
agaaacaatgttgaacaatcaaatttagttgagaaaatgatgatggaagttctagactcttggattgcagctgaatttctctgttctccgcttgtgagat |
111 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7891538 |
agaaaccatgttgaaccatcaaatttacttgagaaaatgatgatggaagttctacacgctttgattgcagctgaatttctctgttctccgcttgtgagat |
7891637 |
T |
 |
| Q |
112 |
cgtgattgttgatgtaaacagcatatccagcttgtgtgagagcggaagagagatccaatgcaaaagatttaccaatgtctttgtcatggtaactcaaaaa |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7891638 |
cgtgattgttgatataaacagcatatccagcttgtgtgagagcggaagagagatccaatgcaaaagatttaccaatgtatttgtcatggtaactcaaaaa |
7891737 |
T |
 |
| Q |
212 |
cacatcgtacatccaaagatgatgagga |
239 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
7891738 |
cacatcgaacatccaaagatgatgagga |
7891765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University