View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16811_high_14 (Length: 339)

Name: NF16811_high_14
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16811_high_14
NF16811_high_14
[»] chr7 (2 HSPs)
chr7 (4-162)||(32860727-32860883)
chr7 (170-212)||(32860166-32860208)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 4 - 162
Target Start/End: Complemental strand, 32860883 - 32860727
Alignment:
4 ttttcacctttgctctgtgatttgggggaataataagaatttttagatagagatgaaaattagaaacgttttgagatttttaatggaaaaaatttgttca 103  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
32860883 ttttaacctttgctctgtgatttgggggaataataagaatttttagatagagatgaa--ttagaaacgttttgagatttttaatggaaaaaatttgttca 32860786  T
104 agttgtgaggtggtggggtgccactaccgtcttccagaactagatagatattttcttta 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32860785 agttgtgaggtggtggggtgccactaccgtcttccagaactagatagatattttcttta 32860727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 32860208 - 32860166
Alignment:
170 atgaccagaattagatattttctactagttcagaggtttggca 212  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
32860208 atgaccagaattagatattttctactagttcaaaggtttggca 32860166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University