View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_high_14 (Length: 339)
Name: NF16811_high_14
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 4 - 162
Target Start/End: Complemental strand, 32860883 - 32860727
Alignment:
| Q |
4 |
ttttcacctttgctctgtgatttgggggaataataagaatttttagatagagatgaaaattagaaacgttttgagatttttaatggaaaaaatttgttca |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860883 |
ttttaacctttgctctgtgatttgggggaataataagaatttttagatagagatgaa--ttagaaacgttttgagatttttaatggaaaaaatttgttca |
32860786 |
T |
 |
| Q |
104 |
agttgtgaggtggtggggtgccactaccgtcttccagaactagatagatattttcttta |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860785 |
agttgtgaggtggtggggtgccactaccgtcttccagaactagatagatattttcttta |
32860727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 32860208 - 32860166
Alignment:
| Q |
170 |
atgaccagaattagatattttctactagttcagaggtttggca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32860208 |
atgaccagaattagatattttctactagttcaaaggtttggca |
32860166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University