View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_low_10 (Length: 373)
Name: NF16811_low_10
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_low_10 |
 |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 72 - 356
Target Start/End: Complemental strand, 615503 - 615219
Alignment:
| Q |
72 |
attaaaaatgatgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgctgcttgatacataaatt |
171 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
615503 |
attaaaaatgctgcgtttgccgggagtcgaacccggatctattgcttggaaggcaattatcctaaccgttggactacaaacgctacttgagacataaatt |
615404 |
T |
 |
| Q |
172 |
ctaattttctactgatatatcagtttgcttgagaaggatcctttccatatcaatggctttgtatcnnnnnnnactactatgaagattatcattacgagtc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| || |
|
|
| T |
615403 |
ctaattttctactgatatatcagtttgcttgagaaggatcctttccatatcaatggctttatatctttttttactactatgaagattatcattacgactc |
615304 |
T |
 |
| Q |
272 |
aaatattcttgagctttggtatttaatgaactacggtgcataaaataagaaagaaccatccataaaataatcatagtttcttttt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
615303 |
aaatattcttgagctttggtatttaatgaactacggtgcataaaataagaaaaaaccgtccataaaataatcttagtttcttttt |
615219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Complemental strand, 41515029 - 41514956
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41515029 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
41514956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 5197850 - 5197922
Alignment:
| Q |
83 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5197850 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
5197922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 82 - 154
Target Start/End: Complemental strand, 38695447 - 38695375
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38695447 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
38695375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 83 - 154
Target Start/End: Original strand, 4824236 - 4824307
Alignment:
| Q |
83 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4824236 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
4824307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 41702218 - 41702291
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41702218 |
atgcgtttgccgggagtcaaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
41702291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 7e-34; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Complemental strand, 10739784 - 10739711
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10739784 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
10739711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Complemental strand, 35485465 - 35485392
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35485465 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
35485392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 36100759 - 36100832
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36100759 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
36100832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 82 - 154
Target Start/End: Original strand, 9819669 - 9819741
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9819669 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
9819741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 36020482 - 36020555
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36020482 |
atgcgtttgccaggagtcgaacccaggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
36020555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 82 - 153
Target Start/End: Original strand, 6057515 - 6057586
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacg |
153 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
6057515 |
atgcgtttgccgggagtctaacccaggtctattgcttggaaggcaattattccaactgttggactacaaacg |
6057586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 224
Target Start/End: Complemental strand, 20107894 - 20107847
Alignment:
| Q |
177 |
tttctactgatatatcagtttgcttgagaaggatcctttccatatcaa |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20107894 |
tttctactgataatacagtttgcttgagaaggatcctttccatatcaa |
20107847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 7e-34; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 42461226 - 42461299
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42461226 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
42461299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 12694512 - 12694584
Alignment:
| Q |
83 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694512 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
12694584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 83 - 152
Target Start/End: Original strand, 12694216 - 12694285
Alignment:
| Q |
83 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694216 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaac |
12694285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Complemental strand, 30514435 - 30514362
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30514435 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
30514362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 82 - 154
Target Start/End: Original strand, 38872578 - 38872650
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38872578 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
38872650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 74; Significance: 7e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 34575494 - 34575567
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34575494 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
34575567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 24833093 - 24833165
Alignment:
| Q |
83 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24833093 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
24833165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 49766563 - 49766635
Alignment:
| Q |
83 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766563 |
tgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
49766635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 7e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 82 - 155
Target Start/End: Complemental strand, 23775238 - 23775165
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23775238 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgct |
23775165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 82 - 154
Target Start/End: Complemental strand, 43467608 - 43467536
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43467608 |
atgcgtttgccgggagtcgaacccaggtctattgcttggaaggcaattatcctaaccgttggactacaaacgc |
43467536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 85 - 151
Target Start/End: Complemental strand, 43466710 - 43466644
Alignment:
| Q |
85 |
cgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaa |
151 |
Q |
| |
|
|||||| ||| | ||||||| ||||||| ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
43466710 |
cgtttgtcggaaatcgaacctgggtctaatgcttagaaggcaattatcctaaccattggactacaaa |
43466644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 82 - 153
Target Start/End: Original strand, 16940 - 17011
Alignment:
| Q |
82 |
atgcgtttgccgggagtcgaacccgggtctattgcttggaaggcaattatcctaaccgttggactacaaacg |
153 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
16940 |
atgcgtttgccgggagtctaacccaggtctattgcttggaaggcaattattccaactgttggactacaaacg |
17011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 93 - 136
Target Start/End: Original strand, 38511 - 38554
Alignment:
| Q |
93 |
gggagtcgaacccgggtctattgcttggaaggcaattatcctaa |
136 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38511 |
gggagttgaacccgggtctattgcttggaaggcaattgtcctaa |
38554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University