View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_low_11 (Length: 369)
Name: NF16811_low_11
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 334
Target Start/End: Original strand, 16682953 - 16683274
Alignment:
| Q |
8 |
agaagcataggaaagaagccagcgcaaggaagcaatcgaaaagcacgtcacaccgacttgtcgcatttagaggacacgaaacccactctcctctcattct |
107 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16682953 |
agaagcaaaggaaagaagccagcgcaaagaagcaatcgaaaagcacgtcacaccgacttgtcgcatttagaggacacgaaacccactctcctctcattct |
16683052 |
T |
 |
| Q |
108 |
gctatttcactcttcttgtgttttctttttatccaagaacaagaaagtttttcggaatttatcggcctcatagaacacttcaccaacaacaagtttctac |
207 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16683053 |
actattgcactcttcttgtgttttctttttatccaataa------agtttttcggaatttatcgggctcatagaacacttcaccaacaacaagtttctac |
16683146 |
T |
 |
| Q |
208 |
accgatacaaacaatcaaattttcaatctttgttgattcagagtaactttttattaattgaatcaacttagttgccgtgcatttgtctttttcatg-tat |
306 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||| ||||| ||| |
|
|
| T |
16683147 |
accgatacaaacagtcaaattttcagtctctgttgattcaggttaactttttattaactgaatcaacttagttgatgtgcatttgtctttgtcatgatat |
16683246 |
T |
 |
| Q |
307 |
taatgcttcggttttcgaaagtaaagaa |
334 |
Q |
| |
|
|||| |||| ||||||||||| |||||| |
|
|
| T |
16683247 |
taattcttctgttttcgaaagaaaagaa |
16683274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University