View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_low_12 (Length: 360)
Name: NF16811_low_12
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 345
Target Start/End: Original strand, 14545580 - 14545911
Alignment:
| Q |
7 |
tcgaagaaaatcaaggaaaataattaacnnnnnnnngaagaaaggtaaaccctaatacatccacatcacacagatacacacacataccctctttctatgc |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14545580 |
tcgaagtaaatcaaggaaaataattaacaaaaaaa-gaagaaaggtaaaccctaatacatccacatcacacagatatacacacataccctctttctatgc |
14545678 |
T |
|
| Q |
107 |
gtgtgcagnnnnnnnnnnnnnggtcaaattttgtgtgcagttataacgtgagttttatggaatgcttttcagatttcactgttaaaccgtaatgtaatct |
206 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14545679 |
gtgtgcagtttttttgtttttggtcaaattttgtgttcagttataacgtgagttttatggaatgcttttcagatttcactgttaaaccgtaatgtaatct |
14545778 |
T |
|
| Q |
207 |
gtgatagtttgatattgttataagaaaagtttgtggtgtttggtcattcaatttcaaacctttcttcttttacagttacacgggtctttaattacactag |
306 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14545779 |
gtgatagtttgattttgttataagaaaagtttgtggtgtttggtca------ttcaaacctttcttcatttacagttacacgggtctttaattacactag |
14545872 |
T |
|
| Q |
307 |
cctctttactctagagatttttgtcttgtttgtactttt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14545873 |
cctctttactctagagatttttgtcttgtttgtactttt |
14545911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University