View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_low_20 (Length: 313)
Name: NF16811_low_20
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 10 - 299
Target Start/End: Original strand, 18246537 - 18246827
Alignment:
| Q |
10 |
agatgaagaaagagattggttttcttgtgaagagatcatgagttcatttcactatctattctgacaagacaaaagctatgtaacaaaagaatattattaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18246537 |
agatgaagaaagagattggttttcttgtgaagagatcatgagttcatttcactatctattctgacaagacaaaagctatgtaacaaaagaatattattaa |
18246636 |
T |
 |
| Q |
110 |
atctttgtgttggagactatattatgtaacatgagaaagcaaagtttgacagacagtgtaaggttaagaggaaaaagttttgcagtgagaaggaagggta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18246637 |
atctttgtgttggagactatattatgtaacatgagaaagcaaagtttgacagacagtgtaaggtgaagaggaaaaagttttgcagtgagaaggaagggta |
18246736 |
T |
 |
| Q |
210 |
aagagacctggacagcaaaggtgc-nnnnnnnnnaaacagaaacaggaaaactccacaaggttttttcactctttcatcactgtcctatat |
299 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18246737 |
aagagacctggacagcaaaggtgcttttttttttaaacagaaacaggaaaactccacaaggttttttcactctttcatcactgtcctatat |
18246827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University