View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_low_27 (Length: 235)
Name: NF16811_low_27
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 3046211 - 3046414
Alignment:
| Q |
1 |
tacatcaatcatacctagtggaaagacacacgtctttctccgcttccataaattaactacaatcattgagcttccaaatatggaagacttccttcatcca |
100 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3046211 |
tacatcaatcataactagtggaaagacgcacgtctttcttcgcttccataaattaactacaatcattgagcttccaaatatggaagtcttccttcatcca |
3046310 |
T |
 |
| Q |
101 |
accaaatcgagattcattcttcccatcatatattccaagaacatctaactaacggaatgatatcctttctcaaaatccaccttcactaacaaacaccctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3046311 |
accaaatcgagattcattcttcccatcatatattcc----------aactaacggaatcatatcctttctcaaaatccaccttcactaacaaacaccctt |
3046400 |
T |
 |
| Q |
201 |
ttctacttcttttc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3046401 |
ttctacttcttttc |
3046414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University