View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16811_low_33 (Length: 208)
Name: NF16811_low_33
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16811_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 117 - 193
Target Start/End: Complemental strand, 40995764 - 40995688
Alignment:
| Q |
117 |
gattacaatctccaagtagatgggatcgatgttttatatgaaaacattgaagcctcacccgttgactttgttgaatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40995764 |
gattacaatctccaagtagatgggatcgatgttttatatgaaaacattgaagcctcacccgttgactttgttgaatg |
40995688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 40995866 - 40995832
Alignment:
| Q |
15 |
ataggtaaccgtggcacaacattcccattttctcc |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40995866 |
ataggtaaccgtggcacaacattcccattttctcc |
40995832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University