View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16811_low_33 (Length: 208)

Name: NF16811_low_33
Description: NF16811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16811_low_33
NF16811_low_33
[»] chr2 (2 HSPs)
chr2 (117-193)||(40995688-40995764)
chr2 (15-49)||(40995832-40995866)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 117 - 193
Target Start/End: Complemental strand, 40995764 - 40995688
Alignment:
117 gattacaatctccaagtagatgggatcgatgttttatatgaaaacattgaagcctcacccgttgactttgttgaatg 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40995764 gattacaatctccaagtagatgggatcgatgttttatatgaaaacattgaagcctcacccgttgactttgttgaatg 40995688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 40995866 - 40995832
Alignment:
15 ataggtaaccgtggcacaacattcccattttctcc 49  Q
    |||||||||||||||||||||||||||||||||||    
40995866 ataggtaaccgtggcacaacattcccattttctcc 40995832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University