View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16813_high_12 (Length: 300)
Name: NF16813_high_12
Description: NF16813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16813_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 38 - 287
Target Start/End: Complemental strand, 45790481 - 45790232
Alignment:
| Q |
38 |
tttaacacactctttctaacacgttcctccctaaaaagaagaatcacatgagtcttatttctttactaatgtgtcccaccaaatagaaaatgggacccac |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45790481 |
tttaacacactctttctaacacgttcctcgctaaaaagaagaatcatgtgagtcttatttctttactaatgtgtcccaccaaatagaaaatgggacccac |
45790382 |
T |
|
| Q |
138 |
accacatagtaaacctacaataccaacatttcaaattgcttgttgttacttgttgcacgaccgacgacacccacatatatgattacattcaatttttcaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45790381 |
accacatagtaaacctacaataccaacatttcaaattgctagttgttacttgttagacgaccgacgacacccacatatatgattacattcaatttttcaa |
45790282 |
T |
|
| Q |
238 |
ttttctcatgctattactaatgtcaacatgtcaatgtttgtggaatgtct |
287 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45790281 |
ttttctcatgctattattaatgtcaacatgtcaatgtttgtggaatgtct |
45790232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University