View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16813_high_15 (Length: 262)
Name: NF16813_high_15
Description: NF16813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16813_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 5021764 - 5022001
Alignment:
| Q |
18 |
agttttagatggtgcttttactcggaaagatccgttaaaagttcctgaaggttagtgacagactattggtctgtagttggcattaccttgtagaattgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5021764 |
agttttagatggtgcttttactcggaaagatccgttaaaagttcctgaaggtcagtgacagactattggtctgtagttggcattaccttgtagaattgca |
5021863 |
T |
 |
| Q |
118 |
ttgtcatg-attaagttataatgtgtgctttattttccgtaggaaagtattttctcgcacgtgcagggttgacgacaaaacctggggtgctgacaccata |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5021864 |
ttgtcatgtattaagttataatgtgtgctttatttt-cgtaggaaagtattttctcgcacgtgcagggttgacgacaaaacctggggtgctgacaccata |
5021962 |
T |
 |
| Q |
217 |
tagaggtgtttgttattgcttgaagcagtattcatctca |
255 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
5021963 |
tagaggtgtctgttattgcttgaagcagtattcaactca |
5022001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University