View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16813_high_3 (Length: 512)
Name: NF16813_high_3
Description: NF16813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16813_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 204 - 496
Target Start/End: Original strand, 52611309 - 52611601
Alignment:
| Q |
204 |
gccaccaccgcaacaatcctccaccaccgttaccgcgattcaacctcaatccgacattgacactgccaccgtcgatgatcatgaatctgttgaacccatt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52611309 |
gccaccaccgcaacaatcctccaccaccgttaccgcgattcaacctcaatccgacattgacagtgccaccgtcgatgatcatgaatctgttgaatccatt |
52611408 |
T |
 |
| Q |
304 |
gttgatactcgtacggacgaggttgatgatgcgattctagctttgaaggaatgcgatttatacaatggaacttgggtagaggatggagattatccgattt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52611409 |
tttgatactcgtacggacgaggttgatgatgcgattctagctttgaaggaatgcgatttatacaatggaacttgggtagaggatggagattatccgattt |
52611508 |
T |
 |
| Q |
404 |
atgagccaggttcttgtccttacgttgatgaagcttatgattgcaaaatcaatggaagaaatgatactcattataccaaatggcgttggaaac |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
52611509 |
atgagccaggttcttgtccttacgttgatgaagcttatgattgcaaaatcaatggaagaaatgatactcgttataccaaatggcgctggaaac |
52611601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 14 - 66
Target Start/End: Original strand, 52611119 - 52611171
Alignment:
| Q |
14 |
aatgaacatgactgaaaatgattttccacaataatcgtcacactgtcgcgacc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52611119 |
aatgaacatgactgaaaatgattttccacaataatcgtcacactgtcgcgacc |
52611171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University