View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16813_low_12 (Length: 349)
Name: NF16813_low_12
Description: NF16813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16813_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 30589681 - 30590012
Alignment:
| Q |
1 |
ttctgaggctactattgatgatgtgttggaaaagggtagggagttttgtgnnnnnnnntgggacgtggctaagaaaagtgttgctccacagccttttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30589681 |
ttctgaggctactattgatgatgtgttggaaaagggtagggagttttgtgaaaaaaaatgggacgtggctaagaaaagtgttgctccacagccttttatc |
30589780 |
T |
 |
| Q |
101 |
gagcaatattgtttcagggggccttatgttgcatctttgctgagagagggtttgcatattacagatagacatataactgttggctctggaagtatcactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30589781 |
gagcaatattgtttcagggggccttatgttgcgtctttgctgagagagggtttgcatattacagatagacatataactgttggctctggaagtatcactt |
30589880 |
T |
 |
| Q |
201 |
ggacgcttggggtggctttgttggaagctgggaagtcttattcgaccagatttgggcttcgtggatttgacttggttcagatgaagatgaatcctctgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30589881 |
ggacgcttggggtggctttgttggaagctgggaagtcttattcgaccagatttgggcttcgtggatttgacttggttcagatgaagatgaatcctctgat |
30589980 |
T |
 |
| Q |
301 |
tcttattcccattttgttactttctcttattc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30589981 |
tcttattcccattttgttactttctcttattc |
30590012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 143 - 331
Target Start/End: Complemental strand, 10260015 - 10259827
Alignment:
| Q |
143 |
agagagggtttgcatattacagatagacatataactgttggctctggaagtatcacttggacgcttggggtggctttgttggaagctgggaagtcttatt |
242 |
Q |
| |
|
||||||||||||||||||| |||| || || ||||||||||||| || ||||||||||| |||||||| || ||||| |||||||||||| | |||| |
|
|
| T |
10260015 |
agagagggtttgcatattaatgataatcaaatttctgttggctctggcagcatcacttggacacttggggttgcattgttagaagctgggaaggcatatt |
10259916 |
T |
 |
| Q |
243 |
cgaccagatttgggcttcgtggatttgacttggttcagatgaagatgaatcctctgattcttattcccattttgttactttctcttatt |
331 |
Q |
| |
|
| || |||| |||||||| ||||| ||| | |||| ||| || ||||||| ||||||||| | ||| |||| ||||||||||| |
|
|
| T |
10259915 |
ccactggattcgggcttcggaactttgaattgctccagacgaaaataaatcctcctattcttattgctattgtgttgttttctcttatt |
10259827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University