View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16813_low_22 (Length: 236)
Name: NF16813_low_22
Description: NF16813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16813_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 26622264 - 26622044
Alignment:
| Q |
16 |
gtttcagcaccaattacagacctgtcaaacctgttcctgcacctgtttgctgctgtccacccatgcaacaactgatgtgcacgctcaacaattgactggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26622264 |
gtttcagcaccaattacagacctgtcaaacctgttcctgcacctgtttgctgttgtccacccatgcagcaactgatgtgcacgctcaacaattgactggc |
26622165 |
T |
|
| Q |
116 |
tgctctcggacatattttgccaaacttgaatattccggcttttccacaagctccacactaaagtaacaaataactggattttagtatgtggcagattttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26622164 |
tgctctcggacatattttgccaaacttgaatattccagcttttccacaagctccacactaaagtaacaaataactggattttagtatgtggcagattttg |
26622065 |
T |
|
| Q |
216 |
tagtaaggcaaacactatatc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26622064 |
tagtaaggcaaacactatatc |
26622044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 7175722 - 7175502
Alignment:
| Q |
16 |
gtttcagcaccaattacagacctgtcaaacctgttcctgcacctgtttgctgctgtccacccatgcaacaactgatgtgcacgctcaacaattgactggc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7175722 |
gtttcagcaccaattacagacctgtcaaacctgttcctgcaattgtttgctgctttccacccatgcagcaactgatgtgcacgctcaacaattgactggc |
7175623 |
T |
|
| Q |
116 |
tgctctcggacatattttgccaaacttgaatattccggcttttccacaagctccacactaaagtaacaaataactggattttagtatgtggcagattttg |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7175622 |
tgctctcgggcatattttgccaaacttgaatattccgacttttccacaagctccacactaaagtaacaaataactgaattttagtatgtggcagattttg |
7175523 |
T |
|
| Q |
216 |
tagtaaggcaaacactatatc |
236 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
7175522 |
cagtaaggcggacactatatc |
7175502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University