View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16814_high_10 (Length: 329)
Name: NF16814_high_10
Description: NF16814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16814_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 14 - 313
Target Start/End: Original strand, 49625217 - 49625516
Alignment:
| Q |
14 |
tgagaagaaattacaacgtataatgaaagaaatgattgacatgaaacctggtgcatatccagtcaccggatttccagccggggcgagtggaggcaccgcc |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49625217 |
tgagaagaaattgcaacgtataatgaaagaaatgattgacatgaaacctggtgcatatccagtcaccggatttccagccggggcgagtggaggcaccgcc |
49625316 |
T |
 |
| Q |
114 |
accagcgctgcctgctccaaaaccgtatggtgatctcaataatcgtggcatgtctgaggagtcagaggagaaggtatcaatatccttaggggcaccacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49625317 |
accagcgctgcctgctccaaaaccgtatggtgatctcaataatcgtggcatgtctgaggagtcagaggagaaggtatcaatatccttaggggcaccacat |
49625416 |
T |
 |
| Q |
214 |
ttgaagcagctggagcggctggcaaagttgtgagctccacagtttccaacagtgcaataccagtcaccaggacggacatcagggccggtggtgaaaggaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49625417 |
ttgaagcagctggagcggctggcaaagttgtgagctccacagtttccaacagtgcaataccagtcaccaggacggacatcagggccggtggtgaaaggaa |
49625516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University