View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_high_69 (Length: 243)
Name: NF16815_high_69
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_high_69 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 1808755 - 1808968
Alignment:
| Q |
9 |
gagcagcacagatgtaagtttcctttttgagagagnnnnnnngcactagttttattttcagattattttatttccttccatttcttcttcaaactatgag |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808755 |
gagcagcacaaatgtaagtttcctttttgagaga--aaaaaagcactagttttattttcagattattttatttccttccatttcttcttcaaactatgag |
1808852 |
T |
|
| Q |
109 |
tcaatgttgtaaaaaggaattggagattgaaacgatgaggcatgacgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808853 |
tcaatgttgtaaaaaggaattggagattgaaacgatgaggcatgccgtggtttaaacggctcgaaccaagacaaaaccacgatcgaaccactgaaataac |
1808952 |
T |
|
| Q |
209 |
cgaaccatgccgaaga |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1808953 |
cgaaccatgccgaaga |
1808968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University