View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_high_73 (Length: 239)
Name: NF16815_high_73
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_high_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 20359545 - 20359625
Alignment:
| Q |
8 |
agggttaggtggtggtatatgtgaattgctgattgtgattcattcatttcttccgtgtttcaatgtcgacgatggaattgc |
88 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20359545 |
agggtttggtggtggtatatgtgaattgctgattgtgattcattcattccttccgtgtttcaatgtcgacgatggaattgc |
20359625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 20361085 - 20361129
Alignment:
| Q |
89 |
gcgcaaccaaatactgcgaagaaagtgtgaagtcggacccggaac |
133 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20361085 |
gcgcaaacaaatactgcgaagaaagtgtgaagtcggacccggaac |
20361129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 119
Target Start/End: Original strand, 32194401 - 32194451
Alignment:
| Q |
69 |
aatgtcgacgatggaattgcgcgcaaccaaatactgcgaagaaagtgtgaa |
119 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32194401 |
aatgtggacgatggaattgcgcgcaacgaaatactgcgaagaaagtgtgaa |
32194451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University