View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_high_79 (Length: 222)
Name: NF16815_high_79
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_high_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 10 - 206
Target Start/End: Original strand, 36430608 - 36430807
Alignment:
| Q |
10 |
gcaattatatttagaaaattataaaaagtttttccacaannnnnnnnatatgaaataggttataagaaatggtgtatcattccctnnnnnnnn---tggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36430608 |
gcaattatatttagaaaattataaaaagtttttccacaattttttttatatgaaataggttataagaaatggtgtatcattccctaaaaaaaaaaatggt |
36430707 |
T |
 |
| Q |
107 |
gtatcatatcatatcgtatgaacagattatgtgtttgnnnnnnnacatggaatattatagctactaagtttactttccttgtatgaatacaggtaccttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36430708 |
gtatcatatcatatcgtatgaacagattatgtgtttgtttttttacatggaatattatagctactaagtttactttccgtgtatgaatacaggtaccttt |
36430807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University