View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_high_83 (Length: 201)
Name: NF16815_high_83
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_high_83 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 43672571 - 43672403
Alignment:
| Q |
17 |
agtagaaaaggcacgtactttcactattgatcacaacattcctcatgtcagattgtctctctcaaacaatgacttcgcatggcatggttggcccctctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672571 |
agtagaaaaggcacgtactttcactattgatcacaacattcctcatgtcagattgtctctctcaaacaatgacttcgcatggcatggttggcccctctta |
43672472 |
T |
|
| Q |
117 |
gttcagttagtctctccattcatgttctcttcttgtatttcttgccatttggatgtttttcggcttcat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43672471 |
gttcagttagtctctccattcatgttctcttcttgtatttcttgccatttgggtgtttttcggcttcat |
43672403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University