View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16815_low_11 (Length: 564)

Name: NF16815_low_11
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16815_low_11
NF16815_low_11
[»] chr3 (1 HSPs)
chr3 (11-45)||(30337208-30337242)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 11 - 45
Target Start/End: Original strand, 30337208 - 30337242
Alignment:
11 attattctcattataataaaagtttctcattttat 45  Q
    |||||||||||||||||||||||||||||||||||    
30337208 attattctcattataataaaagtttctcattttat 30337242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University