View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_29 (Length: 425)
Name: NF16815_low_29
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 16 - 421
Target Start/End: Original strand, 36588129 - 36588537
Alignment:
| Q |
16 |
aggaagcatagaaagaagaacttcacgaacaacttgttgttgctgcaaacgagaccgacgcaacattactcttttcgacacatccacaaaactctcataa |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36588129 |
aggaagcatagaaagaagaacctcacgaacaacttgctgttgctgcaaacgagaccgacgcaacattactcttttggacacatcaacaaaactctcataa |
36588228 |
T |
|
| Q |
116 |
tcatactcccaaatatccaaccaacctttcttttccttcttctttttagcattccctattacaggctctgcaaatggttccatttttcgtgcaaacaaag |
215 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36588229 |
tcatactcccaaacatccaacaaacccttcttttccttcttctttttagcattccctattacaggctctgcaaatggttccatttttcgtgcaaacaaag |
36588328 |
T |
|
| Q |
216 |
tcatgaaaaccttctcaaaaatactgtcatcgtaacgtgtcttttgtcctaaaggagcaggttcaccagatggttcagctataccacaccgaatagtagc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36588329 |
tcatgaaaaccttctcaaaaatactgtcattgtaacgtgtcttttgtcctaaaggagctggttcaccagatggttcagctataccacaccgaatggtagc |
36588428 |
T |
|
| Q |
316 |
accacttgctcttggagcatattgtggtggag---ttattagctgaggcacaacctgaaaactaagaactaccattgattaattcacactcttgagtttc |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36588429 |
accacttgctcttggagcatattgtggtggagttattattagctgaggcacaacctgaaaactaagaactaccattgattaattcacactcttgagtttc |
36588528 |
T |
|
| Q |
413 |
atctcactc |
421 |
Q |
| |
|
||| ||||| |
|
|
| T |
36588529 |
atcacactc |
36588537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University