View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_33 (Length: 409)
Name: NF16815_low_33
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 4e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 194 - 408
Target Start/End: Original strand, 30913541 - 30913760
Alignment:
| Q |
194 |
ggaaccacaaatgtagaactatgctctgatgagcttgcttcctactacaaaactgctaatttcgttgcaaccatgaacattttgatattagtagttaac- |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
30913541 |
ggaaccacaaatgtagaactatgctctgatgagcttgcttgctattacaaaactgttaatttcgttgcaaccatgaaaattttgatatttgtagttaact |
30913640 |
T |
|
| Q |
293 |
nnnnnnnct--ctttcaaaattcg--gtatatatctcgagggcttactaatctgaggggtccaatctcaccgtctattgctagttagctttaattacaat |
388 |
Q |
| |
|
|| ||| ||| ||| |||||||||| ||| | |||||||| | ||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
30913641 |
tttttttcttattttttaaactcgatatatatatctcaaggaccgactaatctaatgggtctaatcccaccatctattgctagttagctttaattacaat |
30913740 |
T |
|
| Q |
389 |
tagaaagtcctaagcacaca |
408 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30913741 |
tagaaagtcctaagcacaca |
30913760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 91 - 175
Target Start/End: Original strand, 30913355 - 30913439
Alignment:
| Q |
91 |
acaaacacaaattattaactactaaaataccgaatgtcatcatttctaatgcatatttctaaatcacaatccacaactgctattg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30913355 |
acaaacacaaattattaactactaaaataccgaatgtcatcatttcttatgcatatttctaaattacaatccacaactgctattg |
30913439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University