View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_35 (Length: 404)
Name: NF16815_low_35
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 286 - 383
Target Start/End: Complemental strand, 30549437 - 30549340
Alignment:
| Q |
286 |
tgaataactatttcggttagtggctctataagtatgcaactcgggtaaaatgtcaaattatcaagtaccaccgagtttttactagttctaacacccca |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30549437 |
tgaataactatttcggttagtggctctataagtatggaactcgggtaaaatgtcaaattatcaagtaccaccgagtttttactatttctaacacccca |
30549340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 30549580 - 30549499
Alignment:
| Q |
10 |
catcatcaatgtgtttgtaactacttcatagagtgttagttacagtttttgagtattttttaaactactgaattaagaaatg |
91 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30549580 |
catcaacaatgtgtttgtaactacttcatagagtgttagttacagtgtttgagtattttttaaactactgaattaagaaatg |
30549499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 106 - 137
Target Start/End: Complemental strand, 30549468 - 30549437
Alignment:
| Q |
106 |
ttgtttgattggtggtgcatgctgaaaaaatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30549468 |
ttgtttgattggtggtgcatgctgaaaaaatt |
30549437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University