View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_50 (Length: 296)
Name: NF16815_low_50
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 279
Target Start/End: Original strand, 32489108 - 32489375
Alignment:
| Q |
11 |
catcatcatcaggggtagagaacatagataatttttcatcaacttgttattgatttgagtagaattttgagtaggataaggattgtttggtgaaattggc |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32489108 |
catcttcatcaggggtagagaacatagataatttttcatcaacttgttattgatttgagtagaattttgtgtaggataaggattgtttggtgaaattggc |
32489207 |
T |
|
| Q |
111 |
aacatggtaaaaatgcagggaagacgaaacacaagataagatctcagagaaagagatacagtgaatgacaaatcaagaaaaaatggaccaagaaatcacc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32489208 |
cacatggtaaaaatgcagggaagacgaaacacaagataagat-tcagagaaagagatacagtgaatgacaaatcaagaaaaaatggaccaagaaatcacc |
32489306 |
T |
|
| Q |
211 |
aagaagggaggttgatgaaaagatgatttagtgatagcagtgacatgtacattactcaatgccttttat |
279 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32489307 |
aagaagggagtttgatgaaaagatgatttagtgatagtagtgacatgtacattactcaatgccttttat |
32489375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University