View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_52 (Length: 295)
Name: NF16815_low_52
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 252
Target Start/End: Complemental strand, 47519907 - 47519661
Alignment:
| Q |
5 |
ggtgtaatgatgaggtgatggaaaaccatcacacaatatagcacaattaccctatcttcgattttgaaatgg-tgctaaaattcttgtggaagccgaaga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
47519907 |
ggtgtaatgatgaggtgatggaaaaccatcacacaatagagcacaattaccctatcttcaattttgacatgggtgctaaaattcttgtggaagctgaaga |
47519808 |
T |
 |
| Q |
104 |
ggttagtgtcaaattgagatgttctattcttggtgacactaccaccctttgaacatggtgtggaagacactgtttccatgcatggagaataccattcttg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47519807 |
ggttagtgtcaaattgagatgttctattcttggtgacactaccaccctttgaacatgctgttgaagacactgtttccatgcatggagaataccattcttg |
47519708 |
T |
 |
| Q |
204 |
tgcttgcgctattgtcgagaatacaatcttttgactatcaaagctgttt |
252 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||| |||||||||||||| |
|
|
| T |
47519707 |
tgcttgcgctattgccgaaaatacaatc--ttgagtatcaaagctgttt |
47519661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University