View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_57 (Length: 274)
Name: NF16815_low_57
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 23 - 264
Target Start/End: Complemental strand, 45105270 - 45105029
Alignment:
| Q |
23 |
acaccttacctttcattttccattgattgctgacggctcatgatttcttccccaaaaatctagtcagcttcatcttccttatccttccattttcaatcat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45105270 |
acaccttacctttcattttccattgattgctgacggctcatgatttcttccccaaaaatctagtcagcttcatcttccttatccttccattttcaatcat |
45105171 |
T |
|
| Q |
123 |
aagttgctgttgttgcacctatggctcataaacgtttgcacactctctgattggctatcattcatggaaactggtggacgaaacgaaacacccttcttgg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45105170 |
aagttgctgttgttgcacctatggctcataaacgtttgcacactctctgattggctatcattcatggaaactggtggacgaaacgaaacacccttcttgg |
45105071 |
T |
|
| Q |
223 |
gttttcgttttgtctccaaatttctattatgcgtcgtctctg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
45105070 |
gttttcgttttgtctccaaatttctattatgcgccgtatctg |
45105029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University