View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_66 (Length: 265)
Name: NF16815_low_66
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 43263469 - 43263231
Alignment:
| Q |
12 |
acagacaataataactcacggaaacctcgcttccaatgtccaatacatccaagttagctccacagtccaagtaacaagcattccagaaacaatttgcann |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43263469 |
acagacaataataactcacggaaacctcgcttccaatgtccaatacatccaagttagctccacagtccaagtaacaagcattccagaaacaatttgcatt |
43263370 |
T |
|
| Q |
112 |
nnnnnnnngttttgcatatggactttttt-gaaaggaaacacatgactcgtatctggctttatttcagggcatttcatcaacttgtgcttggataaacag |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43263369 |
ttttttttgttttgcatatggactttttttgaaaggaaacacatgactcgtatctggctttatttcagggcatttcatcaacttgtgcttggataaacag |
43263270 |
T |
|
| Q |
211 |
agttcattgatcaacagctagacgtaaccacaacattaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43263269 |
agttcattgatcaacagctagacgtaaccacaacattaa |
43263231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University